Top » Catalog » SNPs » YSC0000076

$18.00

YSC0000076
[YSC0000076]

YSC0000076
hg38 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
FGC15940
FGC15940
Z1889
Z1889
MF113321
MF113321
ZS4737
ZS4737
ZS10710
ZS10710
BY16791
BY16791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies