Top » Catalog » SNPs » YSC0000076

$18.00

YSC0000076
[YSC0000076]

YSC0000076
hg38 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
ZS9046
ZS9046
ZS7540
ZS7540
ZS4346
ZS4346
ZS4370
ZS4370
ZS6732
ZS6732
FGC22303
FGC22303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies