Top » Catalog » SNPs » P77

$18.00

P77
[P77]

P77
hg38 Position: ChrY:12814267..12814267
Ancestral: G
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: T1a1a1b2b2b1a
Comments: 486 Ya5; below L906/CTS660 > FGC3987
Forward Primer: P77_F CATGTGTGAGTAACTACTTGAGATTACATG
Reverse Primer: P77_R TACATACATATAAATGCATAGACAGAGATAATC
Reviews

Customers who bought this product also purchased
CTS9882
CTS9882
FGC30207
FGC30207
FGC48929
FGC48929
Wish a SNP
Wish a SNP
T-P77 Panel
T-P77 Panel
FGC1350
FGC1350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies