Top » Catalog » SNPs » YP1363

$18.00

YP1363
[YP1363]

YP1363
hg38 Position: ChrY:14825170..14825170
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream YP331 > YP1361
Forward Primer: YP1363v2_F CAACTGGGCTTTTAACCACG
Reverse Primer: YP1363v2_R GGTCCTTTGCTGAAAGTCATG
Reviews

Customers who bought this product also purchased
L145
L145
M343
M343
BY79500
BY79500
M9
M9
Z91
Z91
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies