Top » Catalog » SNPs » A11619

$18.00

A11619
[A11619]

A11619
hg38 Position: ChrY:12228777..12228777
Ancestral: T
Derived: G
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11619_F AAGCTATAAAATTACACACTGAAAAGAACA
Reverse Primer: A11619_R TGCTTTGCATATAACCCAAAGG
Reviews

Customers who bought this product also purchased
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
BY27831
BY27831
BY21077
BY21077
Z2571
Z2571
A11625
A11625
Z2573
Z2573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies