Top » Catalog » SNPs » A11619

$18.00

A11619
[A11619]

A11619
hg38 Position: ChrY:12228777..12228777
Ancestral: T
Derived: G
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11619_F AAGCTATAAAATTACACACTGAAAAGAACA
Reverse Primer: A11619_R TGCTTTGCATATAACCCAAAGG
Reviews

Customers who bought this product also purchased
FGC13109
FGC13109
Z29954
Z29954
P312
P312
BY1058
BY1058
FT37828
FT37828
F1343
F1343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies