Top » Catalog » SNPs » YFS069197

$18.00

YFS069197
[YFS069197]

YFS069197
hg38 Position: ChrY:12495958..12495958
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: YFS069197_F CACTGGTCGATGGAGTGTTG
Reverse Primer: YFS069197_R TGAGGAAACAGACACACCCAC
Reviews

Customers who bought this product also purchased
YFS069220
YFS069220
YFS069212
YFS069212
YFS069095
YFS069095
DYS487
DYS487
A11644
A11644
YFS069457
YFS069457
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies