Top » Catalog » SNPs » FGC32795

$18.00

FGC32795
[FGC32795]

FGC32795
hg38 Position: ChrY:6869324..6869324
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32795_F GCAAACATAAAATTATGCCGC
Reverse Primer: FGC32795_R CATTTGGACAAGGGAAATTACTG
Reviews

Customers who bought this product also purchased
L1335
L1335
FGC4077
FGC4077
P312
P312
S588
S588
DF49
DF49
Y150210
Y150210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies