Top » Catalog » SNPs » FGC32795

$18.00

FGC32795
[FGC32795]

FGC32795
hg38 Position: ChrY:6869324..6869324
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32795_F GCAAACATAAAATTATGCCGC
Reverse Primer: FGC32795_R CATTTGGACAAGGGAAATTACTG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
BY108617
BY108617
M222
M222
M9
M9
A18726
A18726
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies