Top » Catalog » SNPs » FGC32795

$18.00

FGC32795
[FGC32795]

FGC32795
hg38 Position: ChrY:6869324..6869324
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32795_F GCAAACATAAAATTATGCCGC
Reverse Primer: FGC32795_R CATTTGGACAAGGGAAATTACTG
Reviews

Customers who bought this product also purchased
L21
L21
FGC46309
FGC46309
DF41
DF41
A223
A223
L51
L51
FGC4133
FGC4133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies