Top » Catalog » SNPs » FGC32795

$18.00

FGC32795
[FGC32795]

FGC32795
hg38 Position: ChrY:6869324..6869324
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32795_F GCAAACATAAAATTATGCCGC
Reverse Primer: FGC32795_R CATTTGGACAAGGGAAATTACTG
Reviews

Customers who bought this product also purchased
YP4685
YP4685
BY35727
BY35727
FT410057
FT410057
BY35731
BY35731
DF104
DF104
BY81963
BY81963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies