Top » Catalog » SNPs » FGC32805

$18.00

FGC32805
[FGC32805]

FGC32805
hg38 Position: ChrY:16870946..16870946
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32805_F TGAACGATAGGTTGAAGATATTTTGAG
Reverse Primer: FGC32805_R TGCTATGGAAACAGTCCTAATTATCC
Reviews

Customers who bought this product also purchased
DF49
DF49
A7
A7
Z17299
Z17299
Z39589
Z39589
R1b-L513 Panel
R1b-L513 Panel
A3
A3
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16435
$18.00
Haplogroup Info
Other products
Currencies