Top » Catalog » SNPs » FGC32805

$18.00

FGC32805
[FGC32805]

FGC32805
hg38 Position: ChrY:16870946..16870946
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32805_F TGAACGATAGGTTGAAGATATTTTGAG
Reverse Primer: FGC32805_R TGCTATGGAAACAGTCCTAATTATCC
Reviews

Customers who bought this product also purchased
Z16340
Z16340
A8
A8
DF49
DF49
A7
A7
Z17299
Z17299
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies