Top » Catalog » SNPs » A11676

$18.00

A11676
[A11676]

A11676
hg38 Position: ChrY:8980593..8980593
Ancestral: C
Derived: T
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11676_F AATCAGCAGGATGTGTGCC
Reverse Primer: A11676_R CCTGACACCCATGTCTTTAGTCTC
Reviews

Customers who bought this product also purchased
L21
L21
L1335
L1335
M168
M168
Z16943
Z16943
P312
P312
CTS4157
CTS4157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies