Top » Catalog » SNPs » FGC50884

$19.00

FGC50884
[FGC50884]

FGC50884
hg38 Position: ChrY:13961483..13961483
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50884_F AGAAAACTCCATGATCCTGCAG
Reverse Primer: FGC50884_R CAAAGACCTCTACTTTCTTTTTCTTCC
Reviews

Customers who bought this product also purchased
FGC50885
FGC50885
FGC50880
FGC50880
FGC50879
FGC50879
FGC50888
FGC50888
DNA Sample Kit
DNA Sample Kit
FGC50887
FGC50887
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies