Top » Catalog » SNPs » FGC13203

$18.00

FGC13203
[FGC13203]

FGC13203
hg38 Position: ChrY:12025415..12025415
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R2a2a
Comments: Below M479 > M124 > P267
Forward Primer: FGC13203_F CACAGTAGTGTTAAATTGTTTAAGCAAAC
Reverse Primer: FGC13203_R CCTTCCAGCTTAGCCTCCTC
Reviews

Customers who bought this product also purchased
BY14642
BY14642
A692
A692
FGC13184
FGC13184
FGC12586
FGC12586
FGC12615
FGC12615
L295
L295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies