Top » Catalog » SNPs » A9737

$18.00

A9737
[A9737]

A9737
hg38 Position: ChrY:15799799..15799799
Ancestral: G
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-A8100+ Z17925+ Z17928+
Forward Primer: A9737_F ATGGAGAAAGAGAATCCAGCC
Reverse Primer: A9737_R AGAAGTTGTTAAGAGGCATGGG
Reviews

Customers who bought this product also purchased
DF29
DF29
A9724
A9724
Z63
Z63
S2315
S2315
CTS6364
CTS6364
CTS6397
CTS6397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies