Top » Catalog » SNPs » A11752

$18.00

A11752
[A11752]

A11752
hg38 Position: ChrY:7812279..7812279
Ancestral: C
Derived: T
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11752_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: A11752_R TGCACAACAAGCTGACATGAC
Reviews

Customers who bought this product also purchased
Z198
Z198
BY30612
BY30612
BY30636
BY30636
BY3330
BY3330
Z225
Z225
U152
U152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies