Top » Catalog » SNPs » A11752

$18.00

A11752
[A11752]

A11752
hg38 Position: ChrY:7812279..7812279
Ancestral: C
Derived: T
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11752_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: A11752_R TGCACAACAAGCTGACATGAC
Reviews

Customers who bought this product also purchased
YP4295
YP4295
CTS5885
CTS5885
Z2573
Z2573
Z196
Z196
DF27
DF27
DF81
DF81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y6511
1 x Y19107
1 x Z35118
$54.00
Haplogroup Info
Other products
Currencies