Top » Catalog » SNPs » FGC51008

$18.00

FGC51008
[FGC51008]

FGC51008
hg38 Position: ChrY:8593879..8593879
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF98
Forward Primer: FGC51008_F TGCATCATGTCTCAGGGTTG
Reverse Primer: FGC51008_R AGGTGATTTGGAACCTGGTG
Reviews

Customers who bought this product also purchased
L48
L48
S1911
S1911
U106
U106
S18823
S18823
Z381
Z381
Z301
Z301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies