Top » Catalog » SNPs » FGC19502

$18.00

FGC19502
[FGC19502]

FGC19502
hg38 Position: ChrY:7764272..7764272
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: downstream FGC6 > FGC4355
Forward Primer: FGC19502_F CATCTTATCTTTGACAAACCTCATG
Reverse Primer: FGC19502_R TCTGGATATTAGCCCTTTATCAGATAG
Reviews

Customers who bought this product also purchased
FGC19504
FGC19504
FGC19503
FGC19503
FGC4355
FGC4355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies