Top » Catalog » SNPs » FGC19502

$18.00

FGC19502
[FGC19502]

FGC19502
hg38 Position: ChrY:7764272..7764272
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: downstream FGC6 > FGC4355
Forward Primer: FGC19502_F CATCTTATCTTTGACAAACCTCATG
Reverse Primer: FGC19502_R TCTGGATATTAGCCCTTTATCAGATAG
Reviews

Customers who bought this product also purchased
ZS3888
ZS3888
M267
M267
FGC7
FGC7
FGC4340
FGC4340
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies