Top » Catalog » SNPs » A11603

$18.00

A11603
[A11603]

A11603
hg38 Position: ChrY:7819531..7819531
Ancestral: C
Derived: A
Reference: Colin Munro (2016)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > Y12059
Forward Primer: A11603_F CTGAGAGTAACATTATCAGGGTGG
Reverse Primer: A11603_R ACCGGTCTACATTGGGCAC
Reviews

Customers who bought this product also purchased
A11602
A11602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies