Top » Catalog » SNPs » A35

$19.00

A35
[A35]

A35
hg38 Position: ChrY:15459538..15459538
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A35_F TTCCCCAGCATAGATGAAATG
Reverse Primer: A35_R ACCATTCCGGAGAAGCAAAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies