Top » Catalog » SNPs » BY4141

$18.00

BY4141
[BY4141]

BY4141
hg38 Position: ChrY:8220612..8220612
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of BY4142
Forward Primer: BY4141_F CCATACAGTGCAAGTTGGGTG
Reverse Primer: BY4141_R GGCCTTAAGTTTCTAATCAAAGACG
Reviews

Customers who bought this product also purchased
A14794
A14794
A14793
A14793
R1b-BY4140 Owsley Panel
R1b-BY4140 Owsley Panel
A14797
A14797
A14796
A14796
A14795
A14795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies