Top » Catalog » SNPs » A160

$18.00

A160
[A160]

A160
hg38 Position: ChrY:8574687..8574687
Ancestral: C
Derived: T
Reference: Steve Goodrich (2014)
ISOGG Haplogroup: E1b1b1a1b1a~
Comments: Found in a hg E-V13 person
Forward Primer: A160_F CCAACCTATTAGTGGCCTGTCT
Reverse Primer: A160_R TCCCTCTCTGACCCTATTGC
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Z5017
Z5017
Z17293
Z17293
E1b-V13 Panel
E1b-V13 Panel
A2192
A2192
L17
L17
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies