Top » Catalog » SNPs » FGC3197

$18.00

FGC3197
[FGC3197]

FGC3197
hg38 Position: ChrY:8084567..8084567
Ancestral: T
Derived: C
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R-DF21 person
Forward Primer: FGC3197_F AGTAGCATCACCCATGTGTAGGA
Reverse Primer: FGC3197_R TGTGAAATAACAGTGGAACAGGG
Reviews

Customers who bought this product also purchased
Z17994
Z17994
Z39298
Z39298
Z29546
Z29546
DF21
DF21
CTS3386
CTS3386
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies