Top » Catalog » SNPs » FGC3197

$18.00

FGC3197
[FGC3197]

FGC3197
hg38 Position: ChrY:8084567..8084567
Ancestral: T
Derived: C
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R-DF21 person
Forward Primer: FGC3197_F AGTAGCATCACCCATGTGTAGGA
Reverse Primer: FGC3197_R TGTGAAATAACAGTGGAACAGGG
Reviews

Customers who bought this product also purchased
DF21
DF21
CTS3386
CTS3386
DF13
DF13
Z253
Z253
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies