Top » Catalog » SNPs » FGC3197

$18.00

FGC3197
[FGC3197]

FGC3197
hg38 Position: ChrY:8084567..8084567
Ancestral: T
Derived: C
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R-DF21 person
Forward Primer: FGC3197_F AGTAGCATCACCCATGTGTAGGA
Reverse Primer: FGC3197_R TGTGAAATAACAGTGGAACAGGG
Reviews

Customers who bought this product also purchased
S971
S971
Z39589
Z39589
L513
L513
FGC18205
FGC18205
DF49
DF49
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies