Top » Catalog » SNPs » S7714

$18.00

S7714
[S7714]

S7714
hg38 Position: ChrY:19184008..19184008
Ancestral: T
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below L161.1 > Y3724
Forward Primer: S7714_F AAAGAGTGAACCCTCATGGAAC
Reverse Primer: S7714_R TCATCCCAGTTGGTTTAGGC
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
BY92499
BY92499
BY128554
BY128554
A22306
A22306
A10514
A10514
P37.2
P37.2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies