Top » Catalog » SNPs » BY4600

$18.00

BY4600
[BY4600]

BY4600
hg38 Position: ChrY:6878171..6878171
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream Z5017 > Z5016 > SK888
Forward Primer: BY4600_F ATTCTCCCCTATCAGAGCAATTTC
Reverse Primer: BY4600_R AGATCCAGCACTGCCATCTG
Reviews

Customers who bought this product also purchased
Z5018
Z5018
S19928
S19928
Y97307
Y97307
Z5017
Z5017
S26015
S26015
BY4461
BY4461
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies