Top » Catalog » SNPs » BY4600

$18.00

BY4600
[BY4600]

BY4600
hg38 Position: ChrY:6878171..6878171
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream Z5017 > Z5016 > SK888
Forward Primer: BY4600_F ATTCTCCCCTATCAGAGCAATTTC
Reverse Primer: BY4600_R AGATCCAGCACTGCCATCTG
Reviews

Customers who bought this product also purchased
Y97307
Y97307
Z5017
Z5017
S26015
S26015
BY4461
BY4461
E1b-V13 Panel
E1b-V13 Panel
SK888
SK888
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies