Top » Catalog » SNPs » BY4600

$18.00

BY4600
[BY4600]

BY4600
hg38 Position: ChrY:6878171..6878171
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream Z5017 > Z5016 > SK888
Forward Primer: BY4600_F ATTCTCCCCTATCAGAGCAATTTC
Reverse Primer: BY4600_R AGATCCAGCACTGCCATCTG
Reviews

Customers who bought this product also purchased
Z17107
Z17107
Y161798
Y161798
Z16988
Z16988
Z17264
Z17264
Y161799
Y161799
Z5018
Z5018
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies