Top » Catalog » SNPs » FGC50950

$18.00

FGC50950
[FGC50950]

FGC50950
hg38 Position: ChrY:13399671..13399671
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50950_F TTCCCATAATAGCAACCAAATG
Reverse Primer: FGC50950_R GGAAGCAAATTGTGGAAAGG
Reviews

Customers who bought this product also purchased
FGC50953
FGC50953
FGC50952
FGC50952
FGC50951
FGC50951
FGC50949
FGC50949
FGC50948
FGC50948
FGC50954
FGC50954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies