Top » Catalog » SNPs » FGC50951

$18.00

FGC50951
[FGC50951]

FGC50951
hg38 Position: ChrY:14476470..14476470
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50951_F CACTGTGGATGGGCACCTAG
Reverse Primer: FGC50951_R GGGGACATTCAAATGCTGC
Reviews

Customers who bought this product also purchased
FGC50952
FGC50952
FGC50950
FGC50950
FGC50949
FGC50949
FGC50948
FGC50948
FGC50954
FGC50954
FGC50953
FGC50953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies