Top » Catalog » SNPs » Z642

$18.00

Z642
[Z642]

Z642
hg38 Position: ChrY:16047316..16047316
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: not listed
Comments: Equivalent to or downstream from L147
Forward Primer: Z642_F GAAAGCCTTGGCTATACTATTCAGG
Reverse Primer: Z642_R CAAATGGTATTTCTAGTTCCAGATCC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
DYS459
DYS459
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC11
FGC11
FGC1695
FGC1695
DYS454
DYS454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1336
$18.00
Haplogroup Info
Other products
Currencies