Top » Catalog » SNPs » Z642

$18.00

Z642
[Z642]

Z642
hg38 Position: ChrY:16047316..16047316
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: not listed
Comments: Equivalent to or downstream from L147
Forward Primer: Z642_F GAAAGCCTTGGCTATACTATTCAGG
Reverse Primer: Z642_R CAAATGGTATTTCTAGTTCCAGATCC
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC1695
FGC1695
DYS454
DYS454
CDY
CDY
DYS390
DYS390
DYS459
DYS459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x BY33078
1 x BY98896
$54.00
Haplogroup Info
Other products
Currencies