Top » Catalog » SNPs » CTS2731

$18.00

CTS2731
[CTS2731]

CTS2731
hg38 Position: ChrY:12328816..12328816
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: Q1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS2731_F CAGGATCTTGCCATGTTGCT
Reverse Primer: CTS2731_R AAATAAACGACCCTCAGTCATTG
Reviews

Customers who bought this product also purchased
Q1b-L53 Panel
Q1b-L53 Panel
Z36358
Z36358
Z5908
Z5908
Z5915
Z5915
L53
L53
BY119734
BY119734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies