Top » Catalog » SNPs » CTS2731

$18.00

CTS2731
[CTS2731]

CTS2731
hg38 Position: ChrY:12328816..12328816
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: Q1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS2731_F CAGGATCTTGCCATGTTGCT
Reverse Primer: CTS2731_R AAATAAACGACCCTCAGTCATTG
Reviews

Customers who bought this product also purchased
M925
M925
Z19432
Z19432
L56
L56
BZ3477
BZ3477
M848
M848
BY15737
BY15737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies