Top » Catalog » SNPs » CTS2731

$18.00

CTS2731
[CTS2731]

CTS2731
hg38 Position: ChrY:12328816..12328816
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: Q1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS2731_F CAGGATCTTGCCATGTTGCT
Reverse Primer: CTS2731_R AAATAAACGACCCTCAGTCATTG
Reviews

Customers who bought this product also purchased
Y788
Y788
Y27993
Y27993
M3
M3
Y202475
Y202475
Z5906
Z5906
L887
L887
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies