Top » Catalog » SNPs » L887

$18.00

L887
[L887]

L887
hg38 Position: ChrY:20766655..20766655
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: not listed
Comments: Found in a hg Q-M3 WTY participant
Forward Primer: L887_F GATCTTGGTAACTGTGTGTAGAGCC
Reverse Primer: L887_R AGAATCCAGGCTTGTTCAAGC
Reviews

Customers who bought this product also purchased
M3
M3
Y202475
Y202475
CTS2731
CTS2731
Z5915
Z5915
Q1b-L53 Panel
Q1b-L53 Panel
Z36358
Z36358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies