Top » Catalog » SNPs » M848

$18.00

M848
[M848]

M848
hg38 Position: ChrY:12268793..12268793
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: Q1a (not listed)
Comments: Below M3
Forward Primer: M848_F GAAACTGAGTCTGGAGGATCG
Reverse Primer: M848_R CTCCGAGCTGCACAATCAC
Reviews

Customers who bought this product also purchased
Y27993
Y27993
L53
L53
Y202475
Y202475
Z5906
Z5906
L887
L887
L56
L56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies