Top » Catalog » SNPs » M848

$18.00

M848
[M848]

M848
hg38 Position: ChrY:12268793..12268793
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: Q1a (not listed)
Comments: Below M3
Forward Primer: M848_F GAAACTGAGTCTGGAGGATCG
Reverse Primer: M848_R CTCCGAGCTGCACAATCAC
Reviews

Customers who bought this product also purchased
Z5915
Z5915
Q Superclade Panel
Q Superclade Panel
BY119734
BY119734
Z5908
Z5908
Z19432
Z19432
BZ3477
BZ3477
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies