Top » Catalog » SNPs » Z5915

$18.00

Z5915
[Z5915]

Z5915
hg38 Position: ChrY:12806383..12806383
Ancestral: C
Derived: A
Reference: Ray Banks (2013)
ISOGG Haplogroup: Q1a2a1a1a
Comments: Downstream of M3 > M848
Forward Primer: Z5915_F AAAATGTGCTTATTCCCTTTTCTG
Reverse Primer: Z5915_R CCCTGCTCTACAAGGATTGC
Reviews

Customers who bought this product also purchased
Z19432
Z19432
L53
L53
BY119734
BY119734
M925
M925
L890
L890
L56
L56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies