Top » Catalog » SNPs » Z5915

$18.00

Z5915
[Z5915]

Z5915
hg38 Position: ChrY:12806383..12806383
Ancestral: C
Derived: A
Reference: Ray Banks (2013)
ISOGG Haplogroup: Q1a2a1a1a
Comments: Downstream of M3 > M848
Forward Primer: Z5915_F AAAATGTGCTTATTCCCTTTTCTG
Reverse Primer: Z5915_R CCCTGCTCTACAAGGATTGC
Reviews

Customers who bought this product also purchased
Y27993
Y27993
M3
M3
Y202475
Y202475
CTS2731
CTS2731
L887
L887
Q1b-L53 Panel
Q1b-L53 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies