Top » Catalog » SNPs » A12017

$18.00

A12017
[A12017]

A12017
hg38 Position: ChrY:15014392..15014393
Ancestral: del
Derived: ins
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12017_F GAGCTTCAATAGCTGATTCGG
Reverse Primer: A12017_R GGTTATTTTGCCCGTTAGTTGAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies