Top » Catalog » SNPs » A12017

$18.00

A12017
[A12017]

A12017
hg38 Position: ChrY:15014392..15014393
Ancestral: del
Derived: ins
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12017_F GAGCTTCAATAGCTGATTCGG
Reverse Primer: A12017_R GGTTATTTTGCCCGTTAGTTGAC
Reviews

Customers who bought this product also purchased
A88
A88
Z253
Z253
FGC5494
FGC5494
A541
A541
Z39589
Z39589
A2295
A2295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies