Top » Catalog » SNPs » FGC27968

$18.00

FGC27968
[FGC27968]

FGC27968
hg38 Position: ChrY:21818127..21818127
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: A0-T
Comments: .
Forward Primer: FGC27968_F ATATGCACAACAGTATACTATCACATTCTG
Reverse Primer: FGC27968_R TTCAAAGTAAATTGAAGACACCTGC
Reviews

Customers who bought this product also purchased
A541
A541
A12018
A12018
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A956
A956
A12087
A12087
A151
A151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies