Top » Catalog » SNPs » FGC27968

$18.00

FGC27968
[FGC27968]

FGC27968
hg38 Position: ChrY:21818127..21818127
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: A0-T
Comments: .
Forward Primer: FGC27968_F ATATGCACAACAGTATACTATCACATTCTG
Reverse Primer: FGC27968_R TTCAAAGTAAATTGAAGACACCTGC
Reviews

Customers who bought this product also purchased
A661
A661
A195
A195
A716
A716
S1121
S1121
A9865
A9865
A541
A541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies