Top » Catalog » SNPs » BY308

$18.00

BY308
[BY308]

BY308
hg38 Position: ChrY:14463855..14463855
Ancestral: G
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY308_F GACTTGGCTAGGGTTTTCCTG
Reverse Primer: BY308_R TTCCCTTTTGCATCCATCTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY307
BY307
BY305
BY305
FGC5577
FGC5577
BY309
BY309
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies