Top » Catalog » SNPs » A11932

$18.00

A11932
[A11932]

A11932
hg38 Position: ChrY:19128052..19128052
Ancestral: G
Derived: A
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11932_F GTGGGGTTTCTACCAACCTG
Reverse Primer: A11932_R GCCAGAAAACTGAGGGTTTG
Reviews

Customers who bought this product also purchased
Z35041
Z35041
BY34734
BY34734
CTS6904
CTS6904
N Superclade Panel
N Superclade Panel
L1025
L1025
BY134916
BY134916
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies