Top » Catalog » SNPs » A11939

$18.00

A11939
[A11939]

A11939
hg38 Position: ChrY:14922679..14922679
Ancestral: C
Derived: T
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11939_F GCCACCGAAACATTTCACTC
Reverse Primer: A11939_R GCATGGCACAGAACAATAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies