Top » Catalog » SNPs » A11940

$18.00

A11940
[A11940]

A11940
hg38 Position: ChrY:17058998..17058998
Ancestral: T
Derived: C
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11940_F CAGGCTGGTCTAAAACAACTGG
Reverse Primer: A11940_R ACAAGCGCTGCTCTCTTTTG
Reviews

Customers who bought this product also purchased
N Superclade Panel
N Superclade Panel
Z35041
Z35041
BY34734
BY34734
CTS6904
CTS6904
BY41225
BY41225
BY103498
BY103498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies