Top » Catalog » SNPs » Y22056

$18.00

Y22056
[Y22056]

Y22056
hg38 Position: ChrY:15377820..15377820
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Approx. Z6057
Forward Primer: Y22056_F GAAATGCTAGGGCCCACG
Reverse Primer: Y22056_R CCTGCCTCATCAATTTGAGTG
Reviews

Customers who bought this product also purchased
Z6064
Z6064
M201
M201
L24
L24
M168
M168
Z2227
Z2227
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies